EST details — SGN-E237940

Search information 
Request: 237940Match: SGN-E237940
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17041Clone name: cLED-18-G6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184154 is on microarray TOM1: SGN-S1-1-1.1.16.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184154 [TUS-44-A16] Trace: SGN-T192148 EST: SGN-E390822 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237940Length: 287 bp (847 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237940 [] (trimmed) GTATTATCCGTAACATCTGAAAGATCATCAGATGATGGGTATAACTGGCGAAAGTATGGCCAGAAACTTGTTAAAGGAAGTGAATTTCCGAGAAG
CTATTACAAATGTACATATCCAAACTGCGAAGTGAAAAAGATATTTGAGCGGTCACCTGAAGGACAAATAACAGAGATTGTTTATAAAGGTTCTC
ATGATCATCCTAAACCCCAACTGAGCCGCCGATTTTCTCCTGGTGCTCTCATGTCTGTTCAAGAAGATAAATGTGAGAAAGAAGTGTGTTTCAGG
GG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237940] SGN-U562766 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53243 [Download] [View] Facility Assigned ID: TOVCR39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5