Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E237983

Search information 
Request: 237983Match: SGN-E237983
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17056Clone name: cLED-18-H23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181143 is on microarray TOM1: SGN-S1-1-4.4.15.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181143 [TUS-36-D5] Trace: SGN-T193842 EST: SGN-E392516 Direction: 3' Facility: INRA
Clone: SGN-C181143 [TUS-36-D5] Trace: SGN-T193969 EST: SGN-E392643 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237983Length: 618 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237983 [] (trimmed) GTTTTCTTATTATCTTTAAATTTTGTTCTAGTGGAACTGTTCAAAAGCTACTATCTTTAGAAATAATAATTTTTATTAGCTTAGTTGATTGATTA
TGCGATATTATTAATAGCTTAAAAAAATAATTTTTATTAGCTTAGAAATAATAATTTTTATTAACTTAGTTGATTGACTATGCGATATTATTAAT
AGCTTAAAAGAGCTTAGTTGATCAGACTACGAAAGTAAAATAAAAAGAGACGGAAGTCTGTGTCTCGCATCTATTTTTTATTGCACCGTTTAAAC
TAAATAAAATATAGACAACAACATCAAAATATTTGGTAGGAAGACACGATTTATTCAACAGAAATATAGACAACAACATTAAAGTATTTGGTACA
TGAAATCACTATCCAATAAGTGACAGTTCGTTGGCCTTCTCATTTTTTATAAAATAAATAGAAACACAAGAGTTGTCTCAAGTGAAAAAATTGAA
TTATGTTCAACCTTCTTCATATGTTTATACTAATATTACATGAGCGTTAATTTTTGCAGCAATTTGATAAAATATTATTCTAATCCACTTGTGGA
ATTGGATGGGATGTTGAAAAGGATGATTTTCGAGAATTTGGGATTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237983] SGN-U577699 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53286 [Download] [View] Facility Assigned ID: TOVCS48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5