EST details — SGN-E238014

Search information 
Request: 238014Match: SGN-E238014
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16945Clone name: cLED-18-B18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169166 [TUS-5-A4] Trace: SGN-T351083 EST: SGN-E550208 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238014Length: 566 bp (842 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238014 [] (trimmed) TTCTATCTAGGCCTGATGAAGTGAATCTTCATCTTCAGCTACACCTGAGACGTGTTGGTGTTGAAGCTCGACCTGACTTGATCCCTGGTGTTCCA
AAGGATGATAGTGGTGGAAGTTCCAAAGAGCCAAACAACGGAAGAAAGGATGCTGATGATTCATCAGAAAATGATAAAAGAGACTCAGAAACTCC
TCCTACAGAAAGTGCAGAGCCCCCCTTGGCTCCAGAAGCTACCGGTTCTCACGATTTAGATAACCAACTCCTTAAGATGGCCAAACTCTCCAATG
ACACAGGTGAATCTGTCACACCTCCTTCAGAAAATTCATTTTTCCGTGACAAGCAGAACTTACTAGTCTCGAGAGCTATTCTAAACATCACTTGT
GAGATTTTTATTCTTAATATGCTGTCCCTTTACTTAGGGAACTGTACATTAACTGAAAATGTAGCTGCAATGTAGACGCTTGATGGGATAGAATT
TTTGTTCCTCAGTTTCTTTCTGTACATTATGGGTTGGAAAAGTGTCATTGCAAAGACACTATGAAATTGAAGACTCAAGTTTGTGTTGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238014] SGN-U582989 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53317 [Download] [View] Facility Assigned ID: TOVCT09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0015 Quality Trim Threshold: 12.5