EST details — SGN-E238320

Search information 
Request: 238320Match: SGN-E238320
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16809Clone name: cLED-17-K19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238320Length: 234 bp (1141 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238320 [] (trimmed) TACAAATCCATATTATCAAACTTCATACACATAAGGCACATACATATGCACTTACATACAGAAATATCAAATACAGTACTAACAATTATCCTTCA
GAATCCAAAAAAAACAAAAGTGAAGGAAATGAAAAACACTTAAAAACCAAAACAACACAGAAACACAATCATAACATCCCAAAAGTAAAATTAAA
AAAACATTTCATTTCATTTAGTCTTTTTCCTTCTCCTTTTCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238320] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52762 [Download] [View] Facility Assigned ID: TOVCM70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.861 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5