EST details — SGN-E238494

Search information 
Request: 238494Match: SGN-E238494
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16814Clone name: cLED-17-K23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175797 is on microarray TOM1: SGN-S1-1-6.1.11.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238494Length: 400 bp (1087 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238494 [] (trimmed) CAAATGTTCCACTGGGAGATATTGTTAGGACAAGACTGAAGCAATTTTCTATAATGAATAGATTCAAAAAGAAAGCATTGCGGGTCATTGCTGAA
CACTTGAAACTTGAAGAGATTGAAGTAATTAGAGAGATGTTTGCACTGATGGACTCTGATGGTGATGGGAAAATAACATATGATGAATTAAAGGC
TGGACTTAGAAAAGTTGGTTCCCAGTTGGCAGAAGCAGAGATGAAGTTGCTGATGGATGTGGCTGATGTTGATGGAAACGGAGTCCTGGACTATG
GGGAGTTTGTAGCAGTTATAATCCACTTACAGAGAATGGAAAATGATGAGCATTTTCGTAGAGCATTCATGTTCTTTGACAAGGATGGAAGTGGT
TATATTGAGCTAGATGAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238494] SGN-U568260 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52936 [Download] [View] Facility Assigned ID: TOVCM72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0208 Quality Trim Threshold: 14.5