EST details — SGN-E238507

Search information 
Request: 238507Match: SGN-E238507
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16897Clone name: cLED-17-O23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175836 is on microarray TOM1: SGN-S1-1-7.3.11.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175836 [TUS-22-G2] Trace: SGN-T180625 EST: SGN-E368146 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238507Length: 363 bp (1090 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238507 [] (trimmed) GGAGACCATCTTCTGCTTATAATATCAGTTTTCCATTTACAATGAAGAATACATCTTCTTCTAAATCTGTAAAAATGGGGTCTTTTAGCACTATC
AGCTGCAGTATCACTTCTTCATCAGCGTCAACAATGGTGGCTCAGAGGAAACTTCCAATTTTGCTTTTTGATGTTATGGATACTATTGTTCGTGA
CCCTTTTTACCATGATGTCCCTGCCTTCTTCAGAATGTCAATGAAAGAATTGCTGGAAAGCAAGCATCCAACTTCCTGGATTGAGTTTGAAAAAG
GCCTTATCAGTGAGGAGGAGTTGACTAGGAAATTCTTCAAGGATGGAAGATCTTTTTGATATGGAGGTCTCAAAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238507] SGN-U567111 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52949 [Download] [View] Facility Assigned ID: TOVCM96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5