EST details — SGN-E238576

Search information 
Request: 238576Match: SGN-E238576
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16909Clone name: cLED-17-P13
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175839 is on microarray TOM1: SGN-S1-1-4.3.11.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175839 [TUS-22-G5] Trace: SGN-T180442 EST: SGN-E367828 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238576Length: 533 bp (923 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238576 [] (trimmed) GAACTGAAAAGAGAGGACTTCAAAGGTTCTAAGTGGCTGGTACTGAGATATGCCATACTGAATGTAGAAGTTATTAAGGTGGCCATCAAAATAGC
AAAGGAAGAAGGTCTTTTTGTTTCTCTAGATCTTGCCAGCTTTGAGATGGTGAGGAAGTTTAAATCACCTCTAATTGAATTATTGGAGTCGGGAA
ACATAGACCTTTGCTTCGCAAACGAGGATGAAGCAACTGAGCTGCTAAGGGGTGAAGAGAAAGCAGATCCTGATGCAGCACTTGAATATTTGGCT
AAATATTGCAAGTGGGCTGTTGTCACCTTAGCTCAAAACGGATGCATTGCGAAACATGAGAAAGAGTTTGTGCGTGTTCCAGCAATTGGCGAAGC
GAAAGTTACTGATGCTACAGGTGCAGGAGATCTGTTTGCAAGTGGATTTTTGTATGGATTGGTAAGAGGACTGTCACTGGAGGAATGTTGTCGGG
TGGGTTCTTGCAGCGGTGGTTCTGTGATTCGATCTCTTGGGGGTGAGGTAACACCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238576] SGN-U575038 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53018 [Download] [View] Facility Assigned ID: TOVCO91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5