EST details — SGN-E239068

Search information 
Request: 239068Match: SGN-E239068
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60998Clone name: cLEL-9-J10
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60998 [cLEL-9-J10] Trace: SGN-T19550 EST: SGN-E238704 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239068Length: 426 bp (806 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E239068 [] (trimmed) AGCCATAAACTCCAATTTTTAGAAATATAAACTTGCAGCAGTATCTTACAACTTCTCCAGAAAAACATTCATTGAATGGCAATGTCATCAAAGAA
TAATAGAATGCAATTCCTATCTCTATGAGCTGCTAATCATTCACAAGAAAAAGAGAGTATTGAGAACCCACTCCTTCAGCCACGACGATCCTACA
GCTTCAAATGCTGCAGCAATAGCCACGTCATCAATGCAGGACGAACGAAGACTTCAACGAATTAGACCACTTCTTTCTCCCTGTCTTTCATATAG
TGTTCTGTACTAATCTGTACAACCCGATTATGTTATCTCCCAGGGGCCTTTATGGTCTCCGTTTTCATTTCTACATCGATCTACCCCACCACCTA
TGGTTTTTATCGGCTGTCTGTTCTTTACATCATAACCCCTGTCGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239068] SGN-U566995 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T19914 [Download] [View] Facility Assigned ID: cC-esflcLEL9J10d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0135 Quality Trim Threshold: 14.5