EST details — SGN-E239277

Search information 
Request: 239277Match: SGN-E239277
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60981Clone name: cLEL-9-I17
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60981 [cLEL-9-I17] Trace: SGN-T19909 EST: SGN-E239063 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239277Length: 300 bp (954 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E239277 [] (trimmed) AGTTTTACCAAATTCAGTATACTCTATTATGTTGTACACAAGCGGATTTTCACAAAGAATGTGTCAAACAAATGCAAACTGCAGTATGTTATGTT
GTTAACCAAGGGGCTTTTTCTCCATCAAGCCGCGATAATTGTGTGACCAACTGCAGTCATTGGTAACTCATTTTTTAAGCAAAATGTATAAAAAC
ACAACTTCAACGAAAAGAGAAACACAAACTATCTTGTTGATTTATCACTAGATGAGGGTGCTTTGGTTACAGATGAACTTGTCGACTCTTCAGCT
TGCACAAGTTTGCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239277] SGN-U582595 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20123 [Download] [View] Facility Assigned ID: cC-esflcLEL9I17a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0007 Quality Trim Threshold: 12.5