EST details — SGN-E239524

Search information 
Request: 239524Match: SGN-E239524
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18592Clone name: cLED-23-P4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169241 [TUS-5-D7] Trace: SGN-T351041 EST: SGN-E550166 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239524Length: 395 bp (967 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E239524 [] (trimmed) TGGCGTCGTAGCTATGATATTCCTCCTCCGAACGGAGAAAGTTTGGAAATGTGTGCAGAGAGAGCTGTTGCCTACTTCACAGAGCACATTGAACC
CCAACTGGCAAGTGGAAAAAATATAATGATTGCAGCCCATGGGAACTCATTGAGGTCCATCATTATGTATCTTGACAAGCTAACATCCCAAGAGG
TTATAAGTTTGGAGCTTGCCACTGGAATCCCCATGCTTTACATATTCAAAGAAGGAAGGTATATTCGCAGAGGAAGTCCTCCAGCCCCAACTGAG
GCAACAGTCTATGCTTATACAAAGAAATTGGCTCAGTACAGACAAAAGCTAGATGATATGTTTGAGTAACGTGACAAGGGGTTTGCTTTCAGTTG
AAGTAGATTTGATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239524] SGN-U564847 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54489 [Download] [View] Facility Assigned ID: TOVDN86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5