EST details — SGN-E239855

Search information 
Request: 239855Match: SGN-E239855
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20054Clone name: cLED-29-B24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239855Length: 171 bp (367 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E239855 [] (trimmed) TAAAGATAGGTGTGGGCAGTGTAAAGGTGAGAAGGTTGTGCAGGAGAAGAAGGTGTTGGAAGTTGTTGTCGAGATGGCTATGCTTAATGGACAGA
AGATCACATTCCCGGGCGAGGCTGATGAAGCACCTGATACCGGCACTGGGGACATAGCTTTTGTCTTGTGACAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239855] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56143 [Download] [View] Facility Assigned ID: TOVEL12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0404 Quality Trim Threshold: 14.5