EST details — SGN-E239978

Search information 
Request: 239978Match: SGN-E239978
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20243Clone name: cLED-29-N1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169386 [TUS-5-J8] Trace: SGN-T350920 EST: SGN-E550045 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239978Length: 239 bp (329 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E239978 [] (trimmed) CAGCTTCAAAGTAAGTATTTTAAGTTTTGAACTAGTGTTACTTATCTTGTTGGGAACTGTTTTGTTTGATTTTTAAAAGAAAAAATATTAAATGA
TCAAAAAAATTATAATATCTTTTTTGTTTTAAGGTTAAATAAATTGATTTAAAAATTTCATTTTTAATTAAAAGAGGGTAGTAAAATGCTTAAAA
AGCTAAAATAATTTAGTGTGAAATATATTATTTTATTATCATTCTAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239978] SGN-U577701 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56266 [Download] [View] Facility Assigned ID: TOVEK73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.804 Expected Error Rate: 0.0005 Quality Trim Threshold: 14.5