Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E240280

Search information 
Request: 240280Match: SGN-E240280
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C19091Clone name: cLED-25-J22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240280Length: 490 bp (834 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E240280 [] (trimmed) CAGGTAAGAGCTTATGGGAAAGCTGGCAAAGCTGAAAAACTTGGAGCTGTTTTGCGGTTTATTGAGAATTCTGACGTGGCACTTGACACCGTGTT
TTTTAACTGTCTAGTGGATGCATATGGGATGATGGGATGCTTCACAGAGTTGAAAGGGGTGCTCGAGATGATGGAACAAAGTGGATGTAAGCCAG
ATAAGATAACATACAGAAGTATGATCAAAGCATATTCAGTAAATGGAATGACTAACAAAGCATCAGAGCTCCGAAACATACTTGCCTCGTTGGAG
AAGGCACGATAGCTTCATAGTTCAAAGACGATCGATAGCAATGAGCCAAAACGTAACTTTGTGCATCACAAGTTCGTTGGTCAGATAGCTTCTGA
GCCATTGTAAGTGGCTTCAGAAATGGTTGAAAGACATTGCTCATGATGGTCTTAACCTTTAACCGAATGCTGTCAGCAAACATCACCAACGAAAA
CGATCAGTTGGAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240280] SGN-U584678 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55071 [Download] [View] Facility Assigned ID: TOVDV59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5