Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E240373

Search information 
Request: 240373Match: SGN-E240373
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C19198Clone name: cLED-25-O4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169439 [TUS-5-L13] Trace: SGN-T350831 EST: SGN-E549956 Direction: 5' Facility: Avesthagen
Clone: SGN-C169439 [TUS-5-L13] Trace: SGN-T351136 EST: SGN-E550261 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240373Length: 526 bp (707 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240373 [] (trimmed) CAGATCAACTACAACATCTGGTTCTTGCTACCAAGCTCCCGAGGCGTTAAAAGTGGTGAAACCATCACAAAAATGGGACATTTACTCGTACGGAG
TGATCTTGCTTGAAATGATCACGGGAAGAACCCCGATTATCCAAGTAGGTTCTACTGAAATGGATCTCGTAAACTGGATTCACTGGTGCATTGAA
GAGAAGAAGCCACTTTCGGATGTATTGGACTCGTGTTTAGCACAAGATGCTGATAAAGAAGAGGAAATGATCGCGGTTTTGAAGATTGCAATGGC
GTGTGTTCACAGCAGCCCGGAGAGAAGACCTTCAATGAGACACATATCTGATGCATTAGACAGACTGCAAGCTTCCTGTGAATGAACAATTGAAA
CAGAACCTTCAGGCTGGCTTCACATTGCTGCAAGGATTACAGCATCTAACCGATAACCATGAAGCACGATCACTGCTTGGTGCGCGATACATATT
GACTAACAGTAGTAATCTCCACTTGTTTGTGAAGGAATATCTGTTTGAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240373] SGN-U573236 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55164 [Download] [View] Facility Assigned ID: TOVDT86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5