Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E240449

Search information 
Request: 240449Match: SGN-E240449
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17914Clone name: cLED-21-E23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169374 [TUS-5-I20] Trace: SGN-T350806 EST: SGN-E549931 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240449Length: 367 bp (1307 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E240449 [] (trimmed) AAACTCATAAGATGCCATAAACATACAAAATAATAATATAATGTAAAAGTATATAAATAATAGTAAAACTCTTTTACAAAGAGTCAAAAGACTAG
CAAAATAGGGTACAAAGTACAAACTAAAGGTAAGTTAATGAAACAATACAGAGGTGGAATAATTCCTAAGATATTCAAAACTGAGAATACTCAAT
GCAACTATAGGAGAAGCCATTTGAAAGTTTAACTTCACCGATTTCTTGATTTTTTTAGCTTACACAGAGCAGCAACCAACTTTTTTTACAGCTGA
AACATCATCCTTGCCAACATTTATAGTTTGCCCCTTCGGCAACGCAGTAGGATCATCCCCAACTTCGAGTGCTTTCCGACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240449] SGN-U564989 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53850 [Download] [View] Facility Assigned ID: TOVDC36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5