EST details — SGN-E240536

Search information 
Request: 240536Match: SGN-E240536
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17976Clone name: cLED-21-I17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181098 is on microarray TOM1: SGN-S1-1-1.2.15.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181098 [TUS-36-B8] Trace: SGN-T194075 EST: SGN-E392749 Direction: 5' Facility: INRA
Clone: SGN-C181098 [TUS-36-B8] Trace: SGN-T194181 EST: SGN-E392855 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240536Length: 456 bp (1358 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240536 [] (trimmed) TTGCACGAGCTCATTTAGATGTAAAGCCAGATAATATTTATGTGAAAAATGGTGTATATAAGCTTGGTGATTTTGGATGTGCAACTCTTCTTGAT
AAGAGCCAGCCAATTGAAGAGGGTGATGCACGTTATATGCCCCAAGAAATACTTAATGAGAACTATGATCATCTTGACAAAGTTGACATATTCTC
CTTGGGCGCTGCAATATATGAACTTATTAGAGGGTCTTCACTGCCAGAATCAGGGCCTCATTTTCTAAACCTCAGGGAGGGGAAATTGCCTCTTC
TTCCGGGTCACTCCTTGCAATTTCAGAATCTACTCAAGGCAATGATGGACCCAGATCCAACACGTCGTCCTTCTGCAAAAGGCGTTGTGGATAAT
CCAATCTTTGAAAGATGGCAAAGAAATTCCAACAAGTAGATATCCATGTAAATCACTGTTTTCTGGGATTTGTCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240536] SGN-U567234 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53937 [Download] [View] Facility Assigned ID: TOVDC57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0055 Quality Trim Threshold: 12.5