Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E240616

Search information 
Request: 240616Match: SGN-E240616
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18099Clone name: cLED-21-P7
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185902 is on microarray TOM1: SGN-S1-1-5.2.7.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185902 [TUS-48-J12] Trace: SGN-T1909 EST: SGN-E378654 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185902 [TUS-48-J12] Trace: SGN-T192416 EST: SGN-E391090 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240616Length: 474 bp (1338 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E240616 [] (trimmed) GGACTTTTCTCTCTCTCTCTCTTTGGGTGACCTGAGATCACATACAAAAATGGTGAAGGGCCGCGCCGTCCTTAACAGCAGTGAAGGTGTTAGTG
GCACCATCCTCTTCACTCAAGATGGAGATGCTCCAACCACAGTTAATGGAAATATTTCTGGCCTAAAACCTGGACTTCATGGCTTCCATGTCCAT
GCCCTTGGTGATACCACAAATGGCTGTATGTCAACAGGACCACATTACAATCCTGCTGGTAAGGAGCATGGTGCTCCTGAAGATGAGGTGCGTCA
TGCTGGTGATCTTGGTTACATCACAATTGGAGGAAGAAGGTTCTGCATCTTTTACTATTACCGACAAGCAGATTCCTCTCACTGGTCCACAGTCC
ATCATTGGAAGAGCTGTTGTTGATCATGCTGATCCTGATGATCTTGGAAAGGGAGGACATGAACTCAGTAAAAGCACCGGAAATGCTGGCGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240616] SGN-U581590 Tomato 200607 Build 2 168 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54017 [Download] [View] Facility Assigned ID: TOVDE88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0286 Quality Trim Threshold: 14.5