EST details — SGN-E240682

Search information 
Request: 240682Match: SGN-E240682
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18077Clone name: cLED-21-O12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169422 [TUS-5-K20] Trace: SGN-T350826 EST: SGN-E549951 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240682Length: 401 bp (1747 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E240682 [] (trimmed) TGTTCCAGGGTTGCTTAGTGAAAATTTCAATTATGGTGAATAACGAGCTATTTAATTTTTTTTCTAGTTCAATTTATTTATCGTATCTTTTTAAG
TAAAAATATCAACTCTAAATAAGGAGTTATGTTTATCTTACTTCTTTAGTGAAAATTTTGCTTAAACTAAATATCTAATTAAAAAGAACTTTAAT
TTTTTTAATATATATTAAATATTGATGTCGGATTAAATTGAACAAATCGTAGAAAATGATATTCTTTTTGTTTTTTAAACTCTTGCCATAATTTG
GCTTAATATAGACTTTTAGAAAAATAAACTTTTGAAACTTTGATGTTAAACATGTTTTTTCCTTTACGTAACACACTTCTCTTACTTTTATGTGT
TGTCCATTCTAATTTAATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240682] SGN-U580541 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54083 [Download] [View] Facility Assigned ID: TOVDD90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.851 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5