EST details — SGN-E240751

Search information 
Request: 240751Match: SGN-E240751
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18893Clone name: cLED-24-O19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176094 is on microarray TOM1: SGN-S1-1-5.1.10.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176094 [TUS-23-A20] Trace: SGN-T181191 EST: SGN-E369153 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240751Length: 456 bp (763 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240751 [] (trimmed) CAGACGGGGGTTAATCGAGACCACCCGTGGTGCAATCCGATTGGGAGAGAGAGTGTAAATTTGGTGGATACAAGGAATATTCCTAGAATCTTGGT
GTGTATATCTGAGTTAGATATTTTGAGAGACAGAAATTTGGAGTTTTGTGCTACTTTAAATAGAGTTAGTAATAAAAAAGTTGTTGAATATGTTA
TGTTTAAAGGTGTAGGCCATGCATTTCAAGTACTAAGCAAATCTCAAGTTGCACAAACAAGAACAACAGAGTTGATTGAACAAATTAAAGGTTTT
ATCAGTTGAATCTGATGACAAGAATGTACAAAATAAAATCAAAGGATTTAAGTTATATATACATATAATTTATCCTTTCTAATTTTTTTTATGAA
TTACTGATCTATGTTTACTATAGTAGATAATATATGATTTGTAACATGTAACTTATCGTCTTTGTAAGACATAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240751] SGN-U572192 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54648 [Download] [View] Facility Assigned ID: TOVDO94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5