EST details — SGN-E240764

Search information 
Request: 240764Match: SGN-E240764
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18685Clone name: cLED-24-E24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181206 is on microarray TOM1: SGN-S1-1-5.2.14.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240764Length: 198 bp (835 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E240764 [] (trimmed) TTAGAGTTCTCTCATCAAATCCCATCATTCAGAATGACTGGAACTGAAAAAGAGGGTGTACCTGTGGGATCATTTGAACTTGATCCTGCTTCTTT
ACCTCTTAATCCAGACGACATTTGGTACCCTGAGAAACTGAATAAAGACAGCGGAAATTCAAAGTCTGAACTGGAGAATGTGACAACACCTAAGA
AGTTAGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240764] SGN-U579345 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54661 [Download] [View] Facility Assigned ID: TOVDP36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0256 Quality Trim Threshold: 14.5