EST details — SGN-E240982

Search information 
Request: 240982Match: SGN-E240982
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18828Clone name: cLED-24-L13
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240982Length: 383 bp (655 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E240982 [] (trimmed) TATCAATGGCAGAAAAAAATGAATCCAATAATAGTGAAGATGGTAGGTGGACTCTTCAAGGGAAAACTGCCCTTGTTACTGGAGGCACTAAAGGC
ATAGGGCATGCCATAGTAGAAGAATTAGCTGGATTTGGTGCTACAGTTTATACATGTTGTAGAAACCAAGAACAACTTGATGAGTGTTTAGAGAA
ATGGAGAGGCAAAGGTTACAAAGTAGAAGGATGTGTATGTGATTTGACTTTGAGATCCCAAAGAGAGATGCTTATGGAGAAGGTTATCAATTTTT
TCCAAGGAAAACTCAACATTCTAATAAATAATGCAGGTATACTAATAGTTAAGCCAGCTACAGAGTTCACTGAGGATGATTACTCTATTCTTATG
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240982] SGN-U578659 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54879 [Download] [View] Facility Assigned ID: TOVDQ67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5