EST details — SGN-E241234

Search information 
Request: 241234Match: SGN-E241234
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C19282Clone name: cLED-26-E12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241234Length: 429 bp (942 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E241234 [] (trimmed) CCTTGTTGTGCACTCTGCTACAAAATTCCTTGGTGGGCACAACGATGTTCTTGCAGGTTGTATTAGTGGTCCTGAAAAATTAGTTTCAGTAATCC
GAAACTTGCATCATATCCTGGGTGGTGCTCTCAATCCTAATGCTGCATATCTTATCATCCGAGGCATGAAGACGCTGCATCTTCGTGTACAGCAA
CAAAATTCTACTGCATTGAGGATGGCCGAAATTTTAGAGGCTCATCCCAAGGTGAAACACGTCTATTATCCAGGCTTGCCGAGTCATCCGGAATA
TCACCTTGCAAAGAAACAAATGACTGGCTTTGGTGGTGTGGTCAGTTTTGAGGTTGATGGAGACCTCCTAACTACTGCAAAATTTGTGGATGCTC
TGAGGATTCCTTATATTGCTCCATCGTTTGGAGGTTGTGAGAGCATTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241234] SGN-U578164 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55428 [Download] [View] Facility Assigned ID: TOVDX30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0203 Quality Trim Threshold: 14.5