Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E241705

Search information 
Request: 241705Match: SGN-E241705
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22093Clone name: cLED-36-H5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169809 [TUS-6-K23] Trace: SGN-T350533 EST: SGN-E549658 Direction: 3' Facility: Avesthagen
Clone: SGN-C169809 [TUS-6-K23] Trace: SGN-T350591 EST: SGN-E549716 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241705Length: 475 bp (750 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E241705 [] (trimmed) CAGATCCTTTTAACAGGTCAAGTTGGATATATAGTTAGCGGAATGCGTTCAACAAAAGAGGCCCGTGTTGGAGATACTCTACATCATACACGAAC
AGTTATACAGCCCCTTCCAGGTTTCAAGCCAGCAAAACATATGGTCTTTTCTGGCCTATATCCAGCTGATGGATCTGATTTTGAGGCACTTAACC
ATGCCATAGAGAGACTGACGTGTAATGATGCCAGTGTCTCTGTAACTAAAGAAAGCAGCACAGCTCTAGGTCTGGGTTTCAGATGTGGTTTCTTG
GGCTTACTTCACATGGATGTTTTTCATCAGCGACTTGAGCAGGCATGTTCATTAAGTCATTTTACAATGTATTTGCCTCAGCTATAACCTAGATT
GATGAATATCAGACAAGGAAGACCACCTATCTTTGGCATAAGGAATTACTTCTCCAGATGTTGGTCTCTCTTGTTGGAACCTCTCTCTCTCTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241705] SGN-U586459 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57875 [Download] [View] Facility Assigned ID: TOVFM39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5