EST details — SGN-E242122

Search information 
Request: 242122Match: SGN-E242122
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22264Clone name: cLED-37-G22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169883 [TUS-6-O1] Trace: SGN-T350540 EST: SGN-E549665 Direction: 3' Facility: Avesthagen
Clone: SGN-C169883 [TUS-6-O1] Trace: SGN-T350623 EST: SGN-E549748 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242122Length: 289 bp (710 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E242122 [] (trimmed) TTTTAAAATGAAACATATATTACAGATCATTAATCATAGTAGTAGTGTTACAAACATGTAAAGCACAAAATATGGGTACTAATGGAGAAATTACA
AATAAACATATGTAACCTGGTTTTAGAGAATATACAGAAAGAATGAGTGATCAACCAATTAAAGACTGAAAGAATCAAATAAAGCAGAAACAAAA
CAATGAGACAAAGTAGCAACTAGGTGTCTTAACTGAAGAGTGATCACTTTATGAGATAGAGATAGTAATAAGTATTAGTTGAGTGACGAGTACTA
GCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242122] SGN-U566130 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57943 [Download] [View] Facility Assigned ID: TOVFP47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5