EST details — SGN-E242790

Search information 
Request: 242790Match: SGN-E242790
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21007Clone name: cLED-31-F5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242790Length: 519 bp (912 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E242790 [] (trimmed) CGGGGCTTATCTTGTTTTCCTTGATTATTGGCAATATGCAGAAACTATTGCAATTTGACCTGGTTAGAGTAGAAGAGATGAGAGCACGGAGGTGG
GATGTAGAACAGTGGATGTCTAATCGCATGCTTCCTGACTCTCTGAGATTGCAAATTAGAAGACATGAAGAGTACAAATGGCAACAAACCAAGGG
AATTGAGGAAGATTCATTCATTCAAAATCTTGCTAGAGACTTGAGGAGAAATTTAAAGCGACATCTCTGTTGGTCTTTGCTATATAGAGTTCCCG
TATTTGAGAAAATGGACGAACAATCACTGGATGTGTTGTGTGATAGACTGAAACCAGCACGCTTCACGGAGATGAGCTACATAATCCGAGAAGGT
GATCCGGTAGAAGAAATGCACTTTCTAATGAGAGGTGCAGTGTCATCTATGACCACAAATGGTGAAGAGACTGGTTTTTTCAGCTCTGTTCATCT
CAAGGCTGGAGACTACTGTGGAAATGAGCTTTTGGCATGGGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242790] SGN-U584363 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56709 [Download] [View] Facility Assigned ID: TOVES27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0095 Quality Trim Threshold: 14.5