Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E242810

Search information 
Request: 242810Match: SGN-E242810
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21150Clone name: cLED-31-N1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181565 is on microarray TOM1: SGN-S1-1-6.1.12.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181565 [TUS-37-E19] Trace: SGN-T199300 EST: SGN-E397974 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242810Length: 555 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E242810 [] (trimmed) GGGATACTTTGCAAGTTACTGTACATTGTGTTAAAACAACAACATGGAATAAAGGTTAAGTAATTGCAGCTAAAAGAGCTGTTCCATTCATGTTT
CAACTTGCTAAAAGTTTAGAAAATCAGAAGTTACGAGATGGTCAGAGCTTATTCACAAGAGCACACATATAAGCATCCATGGGAAAGAGTAACTT
CTGCATCCTGGCGCAAGTTTGCTGATCCTGAGAACAAGCGCATTCTATCGCATATCCTCGAAGTTGACACATTGAACCACAAGCTTGATTCCATC
TCAGGGAGGCTTTATACGACTCGTGCCATAACTATTCATGCACCAGGACCATGGTTCCTCCGCAAAATCATTCGTCAAGACATCTGCCACTGTGT
AGAATCAACTGTTGTTGATGCCCAATCTCGGTCCATGCAGCTCTCCACTCGAAACATTAGTCTGGAGAAGTACATAGAAGTGGAAGAGAAAATCA
GATATGACCCTCATCCAGATAATCCAAAGTTATGGACCGTCTGCAAGCAGGAAACGAGTATCAGGATTAAGCCCTTATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242810] SGN-U576023 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56729 [Download] [View] Facility Assigned ID: TOVES73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5