Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E243308

Search information 
Request: 243308Match: SGN-E243308
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25465Clone name: cLEF-12-H23
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180351 is on microarray TOM1: SGN-S1-1-4.3.19.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243308Length: 471 bp (747 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243308 [] (trimmed) CTCTCCCTTCCTTGCCTATTTTCTTCCTCAATTTTCTCTCTTCTCTTTTTCTCTCTCTCTTTCTTCATTCCACCGATCCAGATCTCAAATCTCCG
AGAGAGTGAAGAAGACGAAGAAGAAAATTGATTAGTAATGGCGGCCGTATCGCCATTAGCAAAGTATAAGCTTGTGTTTTTGGGCGATCAATCTG
TTGGAAAAACCAGCATCATTACTCGCTTCATGTACGATAAATTCGATACCACCTACCAGGCTACCATTGGTATCGATTTTTTGTCCAAGACAATG
TACCTTGAAGATCGTACAGTTCGCTTGCAGCTCTGGGATACTGCTGGTCAAGAGAGATTTAGGAGTCTTATTCCCAGCTACATTAGAGATTCTTC
TGTCGCTGTAATTGTGTTTGATGTTGCCAACCGTCAATCATTTCTAAACACTTCAAAGTGGATTGAGGAAGTACGTACTGAACGGGGAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243308] SGN-U579137 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59505 [Download] [View] Facility Assigned ID: TMGBU48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5