Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E243549

Search information 
Request: 243549Match: SGN-E243549
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21511Clone name: cLED-34-E19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181663 is on microarray TOM1: SGN-S1-1-4.1.12.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181663 [TUS-37-I21] Trace: SGN-T194324 EST: SGN-E392998 Direction: 3' Facility: INRA
Clone: SGN-C181663 [TUS-37-I21] Trace: SGN-T194325 EST: SGN-E392999 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243549Length: 648 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243549 [] (trimmed) CAGAACAGCTTGCAGGGTGAAATTCCTTTTAGTGGTCCTTTCAAGAACCTTTCCAGCCTGTCATTCATGTTCAATGAAGCATTGTGTGGTGCTCC
AAGATTTCATGTCCCTTCGTGCCCCACTTCTTCAAACCATAGATCAAAGAGGAAGAAGTTACTTCTGATAGTCTTTCCTCTACTCGGAGCTGCTG
TGACAATTGTTTTTGTAACATTGGCATTTGTGTGGATGAGGTACAGAAAAGAAGGAAATGTTCCAGTCCAAGCTGATTTGTTAGCTACAAGGGAA
AGAATTTCATACTATGAAATCATACAAGCCACAAATGATTTTAGTGAGAGTAATTTCATTGGTTCAGGGAGTTTTGGTTCTGTTTACAAAGGAAT
TCTCATAAATGGGACTATCATTGCAGTTAAAGTGTTCAACCTACAAGTTGAAGGTGCATTCAAGAGTTTTGAAACAGAATGTGAAGTTCTTCGCA
ACCTTCGCCATAGGAATCTCACCAAAGTCATTAGCAGTTGCTCCAACCTTGATTTCAAGGCTTTAGTGCTCGAGTACATGCCTAATGGGAGCCTT
GAAAAGTGGTTGTATTCACACAACTACTTCTTAGACATCCTTCAAAGACTAAGCATAATGATTGATGTGGCATGTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243549] SGN-U576410 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57323 [Download] [View] Facility Assigned ID: TOVFC34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5