EST details — SGN-E243610

Search information 
Request: 243610Match: SGN-E243610
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21708Clone name: cLED-34-O2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176259 is on microarray TOM1: SGN-S1-1-8.4.10.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176259 [TUS-23-H17] Trace: SGN-T181364 EST: SGN-E368437 Direction: 3' Facility: INRA
Clone: SGN-C176259 [TUS-23-H17] Trace: SGN-T181365 EST: SGN-E368438 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243610Length: 410 bp (803 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243610 [] (trimmed) CAGCAGAATATGAGAACTTAGAAGAATGCATTACGTACTTGTGTGAGTATATAACAAGCAAAGGGCCTTTTGATGGTCTTCTCGGATTCTCCCAG
GGAGCAACTTTATCAGGCCTTTTACTAGGGTACATGGAGCAGGGGGAGATTCTGAAAGAGCATCCACCAATGAAATTATTTGTATCAATATCAGG
TGCCAAATTTAGGGACCCAAATATTTGTAACATTGCATACAAAGATATGATGAAGGTTAAATCAGTTCATTTTATTGGAGAGAAAGATTGGCTCA
AACTTCCTTCACAAGAACTTACAACAGATTTTGAGAATCCTATCATCATAAGGCATCCTNAAGGGCACACTGGGGCAAGAATAGATGAAGCAGCT
GTGGAGACATTGAAAAGTTGGACAAGGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243610] SGN-U567546 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57384 [Download] [View] Facility Assigned ID: TOVFD85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5