EST details — SGN-E243657

Search information 
Request: 243657Match: SGN-E243657
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21734Clone name: cLED-34-P5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176269 is on microarray TOM1: SGN-S1-1-6.1.11.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176269 [TUS-23-I3] Trace: SGN-T181067 EST: SGN-E369493 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243657Length: 420 bp (625 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243657 [] (trimmed) TGAACAGTCTGCAACAAGGAGGGCCACATGGTATGATGAGTATGGGTCAAAAAAGTGGAGGAGGTCCAATGACCATGGGCCCAATGGGTCATATG
TCGGCAGCTCAAGGACTACCCGCCGGTGGTCCTGGCGGTTACCCGGGGATGGGTCAAGGAGGCAACAACCCTTATAGCCAACAACAACAACAGTA
TATGGCACAAATGATGATGAACCAACAGCGGCCTGCCGGATATGACATGTACGGAGCCCATCCAAACATGTACGGTGCCCATCCGATGATGTACG
CCCGGCAACATCCATCCGTGAGTTACGGGCCACCGCCACCTATGGGTGCTCCGGTGCATGATAATTTTACTCATATGTTCAGCGATGAGAATACA
GGCAGCTGTAGTATTATGTAAATGGTTCTTTTTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243657] SGN-U568435 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57431 [Download] [View] Facility Assigned ID: TOVFE87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5