EST details — SGN-E243701

Search information 
Request: 243701Match: SGN-E243701
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21852Clone name: cLED-35-G15
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243701Length: 562 bp (864 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243701 [] (trimmed) CAGGTTCATTAATCAAGCACAACAATATTCAAAGGGTAGGCCAAGTTACCCTCAAGAATTATTCAATTTCATTGCTTCTAAAACACCTTCTCATG
ATCTTGTTTGGGATGTTGGTACTGGTAGTGGCCAGGCTGCTCAATCTTTAGCTAAGCTTTACAAGAATGTGATAGCTACAGACACAAGTCCAAAG
CAGCTTGAATTTGCAGCAAAGGTTCCAAATGTTCAATACATATGTACCTCTCCTAAGTTGTCAAAATCCGAAATCGAAACAAAAATAGGATCAGA
ATCAAGTGTAGATTTAGTAACAATTGCACAAGCAATGCATTGGTTTGATCTACCAACTTTTTATGAACATGTTAAATGGTTACTCAAGAAACCAA
ATGGTGTTATAGCATCATGGTGTTACACTACACCTAAAATAAACAACTCAGTAGATGCAATATTTGATAAATTTTACACAAGTGATGCTGGACCT
TATTGGGAATCACCAAGAAAATTGGTCGATGAAAAGTATGAAACTATTGATTTTCCATTTGAGGCTATAGATGGATGTGATCATAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243701] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57475 [Download] [View] Facility Assigned ID: TOVFG44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5