EST details — SGN-E243928

Search information 
Request: 243928Match: SGN-E243928
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21761Clone name: cLED-35-B24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169713 [TUS-6-G23] Trace: SGN-T350778 EST: SGN-E549903 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243928Length: 419 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243928 [] (trimmed) GTGGAGCTAGTACAACCTAAATGGTACGAGAGGTTGTTAGTTATTGCTGTGCAGGGAGTCTTTTTCAATTTTTACTCTGTGCTTTACTTGCTGTC
CCCCAAGCTTGCACACAGAGTTGTTGGTTATCTGGAAGAGGAGGCTATACACTCTTATACATTGTATCTTAATGATATTGATCGTGGTGAAATTG
AAAATGTTCCTGCTCCTGCAATAGCAATTGACTACTGGAGACTGCCTAAGGATGCAACTCTAAAGGATGTTATTACTGTCATCCGTGCTGATGAA
GCTCATCATAGAGATGTTAACCATTTCGCATCTGATATCCATTATCAAGGAAAGAAATTGCAGGAGGCAGCTGCTCCTATTGGTTACCATTAAAT
CTTCATATTATTCTGCTTTGCATAGCTTCTTTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243928] SGN-U569026 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57702 [Download] [View] Facility Assigned ID: TOVFJ12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0308 Quality Trim Threshold: 14.5