EST details — SGN-E243953

Search information 
Request: 243953Match: SGN-E243953
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21946Clone name: cLED-35-L4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184444 is on microarray TOM1: SGN-S1-1-7.1.16.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184444 [TUS-44-M18] Trace: SGN-T198217 EST: SGN-E396891 Direction: 3' Facility: INRA
Clone: SGN-C184444 [TUS-44-M18] Trace: SGN-T199966 EST: SGN-E398640 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243953Length: 459 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243953 [] (trimmed) CAGACCAAACCCAAAAAAATTCTTGAGAACTTTTTGAAACCTTTTTTCTCAATCTCCAATAAAGGGAAAAATGAGGAGGACTTAGAGAAAATTGC
AGCACAAGAACAGAAGCAATTCCCTTTTGAAGTTCTTGTTTCTGCTACCAAAGATTTTCACCCAGATAACAAGCTTGGTGAAGGTGGATTTGGGC
CTGTATTCAAGGGGAAATTAAGTGATGGGAGGCAAATAGCTGTAAAGAAGCTTTCACATAGTTCAAGGCAAGGGATGAAGGAATTCAAGAATGAA
GCTAAGTTGTTGGCTCGTGTACAACACAGAAATGTGGTGAATTTGTTAGGGTACTGTGTACATGGAGTAGAGAAGTTGCTTGTGTATGAGTATGT
TGCTAATGAGAGCCTTGACAAAATCCTCTTCAAATCTGCTAACAGAGATGCACTCAGCTGGAAGCAACGGCATGACATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243953] SGN-U579043 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57727 [Download] [View] Facility Assigned ID: TOVFJ62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5