EST details — SGN-E243996

Search information 
Request: 243996Match: SGN-E243996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25101Clone name: cLEE-1-M13
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C25101 [cLEE-1-M13] Trace: SGN-T58444 EST: SGN-E243995 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243996Length: 598 bp (883 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E243996 [] (trimmed) GATTATCTTAAATATGCTGCTAGTATTATTATTAAAAGATATGTGATATACATGAAGATTAAAAAGAAAAATATAAATGTTGATCGATAAATTAA
AGTATGATATTTATTAATCTACAAGAAGTATTCTAGAGTTACAATTGCTTAAACAGAACATTATTCAGCAGAATACTTACTACCCAGAGGAGAAG
ATGAAATTTTTCACAGGCGACTCTTTTGCCTTACTGGTGCAGGCTTGAAACTAGCCAAACCAGTAATTTCTCTACCCGTTACCAACGTGTTGATA
TCGTAAGTACCTTCAAATGTATAGATCGGCTCCAAATCGCAAAATGCCTTTGCGACGTGAAAGTCAGCCAAGATTCCGTTGCCACCTAGTAGTTC
TCGTCCGAGAGCAACGGTCTCTCTTGCCCTCAACGTAATCCATGATTTCCCTAAACTTGCGTGACCATGAGTCAGTTTATCACTCTCGTGTAGTT
TGCATAGCCGCCAACCAACAAGAATCATTGCTTGAATGTTGCTCAACATCTGGACTAATTTCTGTTGGTTGATCTGGAAAGCGGCTAATGGTGCT
CCAAACTGCTTCCTCTCCTTCAAGTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243996] SGN-U584054 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58445 [Download] [View] Facility Assigned ID: TSEAA79TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0086 Quality Trim Threshold: 12.5