EST details — SGN-E244133

Search information 
Request: 244133Match: SGN-E244133
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25140Clone name: cLEE-1-O5
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244133Length: 471 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E244133 [] (trimmed) CAGCGAATCCAGCGCCAGCGCGGTCTCAGGCTCCTCCACCTCCTGCTGCTGCTCCCAGACCAATGTCGACAGGACCTAAGAAAAGAGGTAGGCCT
AGGAAGTATAACTAAAAAAGGTTTGATTTTTATGGTTTGTCTCAAGAATTTTGAGTCTTATGGAGATTATAATGCTTAGTTTGATCAACTCGACT
GGAATTGAATGATCGATCGAATCTTGTAGTAAGTTGAGTAGTGAGCAAAAGTAGTTGCTTTTCTTTACTCATCATATGAAGAAGTATATAACTGC
AGAACTGTGCTGTAGCTTGTTCTTGATAGATGCCTTGTGTTTGTAGAAATTTCTCGTTGTTGGTAGATTTTCTGCGGTTTGTAGGTACTATATTT
ATTCAATTGTCAAGACTCGTAGTCATAGACTCGTTTTGTAATTGAATGATCTTTATGCCAAATTTCGAAATTCTAATTTCTGTCTCGTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244133] SGN-U563223 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58582 [Download] [View] Facility Assigned ID: TSEAA87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0192 Quality Trim Threshold: 14.5