| SGN ID: SGN-C24988 | Clone name: cLEE-1-D20 |  | Order Clone |
|
| Library Name: cLEE | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E244182 | Length: 117 bp (816 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E244182 [] (trimmed)
AAAAAGTTGGTTTTGGTGTTTGCAAATGCATAGACATAGAATTTTATGTTTGCATATTCCGTTGTCCTTTGATGACAGACTAAATTTAATGTTAT
TTAATTGACTTCAATTTGAACT
[BLAST] [AA Translate]
| SGN-ID: SGN-T58631 [Download] [View] |
Facility Assigned ID: TSEAD22TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
| Sequence Entropy: 0.740 |
Expected Error Rate: 0.0000 |
Quality Trim Threshold: 12.5 |
