EST details — SGN-E244284

Search information 
Request: 244284Match: SGN-E244284
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26111Clone name: cLEF-37-G1
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26111 [cLEF-37-G1] Trace: SGN-T59875 EST: SGN-E244285 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244284Length: 331 bp (822 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E244284 [] (trimmed) AATCACTTTCTTTACCCAGACAATCGATCCACAGTAAAGAAGATGCAGTTCTTCGGAGGATCAGAGATCAGTCCCTTGGCACCGCCGCCGACAGC
ATCAGGCAATAATGCACATATGCTGTATGTATTCAATAGGAACGGAGTGTGTCTTCTTTACAGGGAATGGAATCAGGCTCTTAAGACTTTAAACC
CTCAGCAGGACCATAAGCTCATGTTCGGCTTGCTCTTCTCTCTCAAATCTTTGACCGCTAAGATGGATCCCACAAGTACTGAAAAAGGTAATCTT
GGGGTGCCGCAATTACCTGGACAAGGATGTTCGTTTCACAGCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244284] SGN-U566273 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59874 [Download] [View] Facility Assigned ID: TMGFO37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0262 Quality Trim Threshold: 14.5