EST details — SGN-E244556

Search information 
Request: 244556Match: SGN-E244556
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22652Clone name: cLED-38-O16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184179 is on microarray TOM1: SGN-S1-1-8.2.16.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184179 [TUS-44-B17] Trace: SGN-T198244 EST: SGN-E396918 Direction: 3' Facility: INRA
Clone: SGN-C184179 [TUS-44-B17] Trace: SGN-T198245 EST: SGN-E396919 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244556Length: 387 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E244556 [] (trimmed) TAAACTTAGACCTGGTCTAAAACCTCAACCTGTCGCTGTAAAATTTTTAGATTTAGATGGCACTCAAGGTCATAGAGAATGGCTGACAGAAGTGA
TATTTTTGGGGCAATTGAGACATACACATCTGGTGAAGTTGATTGGATATTGTTGTGAAGAGGAACACAGGCTGTTGGTCTATGAATATATGCCT
AGAGGGAGCTTGGAGAATCAACTTTTTAGAAGATATTCTGTATCACTTTCATGGTCAACGCGGATGAAAATAGCACTTGGAGCTGCAGAAGGCTT
AGCTTTCCTGCATGAAGCTGAAAAACCAGTCATATATCGTGATTTCAAGGCTACAAATATCTTGTTAGACTTCAGATTACAATGCCAAACTCTCT
GAGTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244556] SGN-U583549 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58168 [Download] [View] Facility Assigned ID: TOVFT92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0323 Quality Trim Threshold: 14.5