EST details — SGN-E244593

Search information 
Request: 244593Match: SGN-E244593
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22675Clone name: cLED-38-P17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244593Length: 306 bp (860 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E244593 [] (trimmed) CTTAAGGCTACTCTGAATGGTCACACAAGGACTGTTAGGGCAATTAGTTCTGACCGAGGGAAGGTGGTATCAGGATCCGATGATCATTCTATTCT
TGTATGGGATAAACAAACAACACAACTACTTGAAGAATTGAAGGGCCACAATGCACAGGTCAGCTATGTGCGCATGCTTTCAGGTGAACGTGTCC
TTACTGCTGCCCATGATGGGACAGTAAAGATGTGGGATGTAAGAACAGATACTTGTGTTGCTACGGTAGGCCGTTGCTCTGGTGCTGATCTTTGC
ATGGAGTATGATGACTCAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244593] SGN-U568481 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58205 [Download] [View] Facility Assigned ID: TOVFU93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5