EST details — SGN-E244817

Search information 
Request: 244817Match: SGN-E244817
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26006Clone name: cLEF-2-K11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C183617 is on microarray TOM1: SGN-S1-1-2.3.2.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183617 [TUS-42-K7] Trace: SGN-T194948 EST: SGN-E393622 Direction: 5' Facility: INRA
Clone: SGN-C183617 [TUS-42-K7] Trace: SGN-T194948 EST: SGN-E399561 Direction: 5' Facility: INRA
Clone: SGN-C183617 [TUS-42-K7] Trace: SGN-T200251 EST: SGN-E399175 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244817Length: 406 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E244817 [] (trimmed) AAAATTTTGATTTTCCTAATAATGTTTCTTGCTATGTTGCTAGTAACAAGTGGGAATAATAATCTAGTAGAGACAACATGCAAGAACACACCAAA
TTATAATTTGTGTGTGAAAACTTTGTCTTTAGACAAAAGAAGTGAAAAAGCAGGAGATATTACAACATTAGCATTAATTATGGTTGATGCTATTA
AATCTAAAGCTAATCAAGCTGCTAATACTATTTCAAAACTTAGGCATTCTAATCCTCCTCAAGCTTGGAAAGATCCTTTGAAGAATTGTGCCTTT
TCGTATAAGGTAATTTTAACAGCAAGTATGCCAGAAGCAATAGAAGCATTAACAAAAGGTGATCCAAAATTTGCAGAAGATGGAATGGTTGGTTC
TTCTGGTGATGCACAAGAATGTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244817] SGN-U579697 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59100 [Download] [View] Facility Assigned ID: TMGAE66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5