EST details — SGN-E245454

Search information 
Request: 245454Match: SGN-E245454
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27342Clone name: cLEF-43-G3
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245454Length: 545 bp (798 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E245454 [] (trimmed) CAAATCCATAACCAATTTGTTGTTGTGCTAAAAAAAAAAAAATTGTTGAAAATTGGGGATTTTTTTTTTTCTCATAAGATTTAATGGCAGGGTCT
GGAAATTCTGGAATTAATCCTGAATTAGTCATTTCCCACAAATTCCCTGAGAGCTTACATACTTACACTGAAAGGGATGCTGCTATTTATGCTCT
TGGTGTAGGAGCATGTACAAAGGATGCTATTGATGATAAAGAACTTAAATATGTTTATCATCAAGATGGGCAAGAATTTATTCAGGTTTTGCCAA
CTTTTTCGACTTTGTTCACTGTTGGAATTCCTTCTCAAATGGAGCGGCTTCCAGGCTTGCAATTTGATCCACGTCTTCTACTGCACGGCCAACAA
TACATTGAAGTCTATAAGCCACTTCCTTCCCATGGCTGCATACTAAATAAAAGGAGTATTGTCGGATTGCATGATAAAGGTAAAGCAGCTGTTCT
TGAAGTAGAAATTGTGAGTTACGAGAAAGAATCTGGTGAACGGCTATGCATGAACCGCTTGTCTATTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245454] SGN-U564563 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60873 [Download] [View] Facility Assigned ID: TMGGM38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0024 Quality Trim Threshold: 20.5