Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E246190

Search information 
Request: 246190Match: SGN-E246190
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26598Clone name: cLEF-40-P9
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176367 is on microarray TOM1: SGN-S1-1-4.1.11.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176367 [TUS-23-M5] Trace: SGN-T181007 EST: SGN-E369433 Direction: 3' Facility: INRA
Clone: SGN-C176367 [TUS-23-M5] Trace: SGN-T181008 EST: SGN-E369434 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246190Length: 483 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246190 [] (trimmed) GAATGGTAGAGAAAGGTGAAAAACCTACAGTTATATCCTATGGAGCGTTGCTCAGTGCTCTAGAAAAAGGCAAGCTCTATGATGAAGCTCTTCAG
GTTTGGAAACATATGATCAAAGTGGGGATCGAGCCAAATTTGTATGCCTATACTATTATGGCATCAATTTACACTGCTCAAGGGAAATTTAACAT
AGTTGATTCTATCATCAAGGAGATGGTTACTACTGGAGTTGAGCCTACAGTTGTTACATTCAACGCTATTATTAGTGGATGTGCTCGGAATGGTA
TGGAAAGTGTTGCATACGAGTGGTTTCAGCGTATGAAAACTCAAAACATAACCCCGAATGAGGTAAGCTATGAAGTGCTAATTGAGGCTCTTGCC
AATGATGGCAAGCCGAGGCTAGCATATGAGTTGTATGTGAGAGCTCTAACTGAAGGCCTGAGTCTTTCTACAAAGGCTTATGATGCAGTCATCTC
ATCTACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246190] SGN-U575916 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60042 [Download] [View] Facility Assigned ID: TMGGC89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0141 Quality Trim Threshold: 14.5