Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E246257

Search information 
Request: 246257Match: SGN-E246257
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26586Clone name: cLEF-40-O7
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176364 is on microarray TOM1: SGN-S1-1-7.1.11.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176364 [TUS-23-M2] Trace: SGN-T181240 EST: SGN-E369202 Direction: 3' Facility: INRA
Clone: SGN-C176364 [TUS-23-M2] Trace: SGN-T181241 EST: SGN-E369203 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246257Length: 575 bp (795 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246257 [] (trimmed) GTCTAAATTTAATTACAATAATTATAACAGAAGGATCAAGACAATTGATAGAAATATAAAACAAATAAGTTCAAAATTAATAGAATAATAAAAGC
AATCGATTGAAAATAAGGAATCAAACAGCAAGCGAGGAATCATTAAGATGCAGAGCAACAAGCTTTCTTGGTGTTTATCTCCTCTGCACCAACAA
CAAGAGTCTTCCCTTCTTTAATGTTAGCAGGTGCAGGATTTCCTGAAGAGAGTGATTTCTTACTGATTATCCGATAAATTTCTGAAAGATTCATC
TGGAAAGCCTTCTCAACATTTGTTGCCTCCAACGCTGATGTTTCTATGAAAGAAAGCCCTTCTCTTTCAGCATAGCTTTGAGCATCCTCTGTAGC
AACTGCTCGCAGATGCTTCAGATCTGTCTTGTTTCCAATCAGCATAATTACAATATTGGAGTCTGCATGATCCCTCAGTTCCTTTAACCACCGGC
TCACATTTTCAAAGGAAATAGGTTTTGTAACATCATATACCAGAAGAGCACCAAGAGCACCCCTATAGTATGCACTCGTAATGGCTCTATATCTC
TCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246257] SGN-U569325 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60109 [Download] [View] Facility Assigned ID: TMGGA88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5