Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E246516

Search information 
Request: 246516Match: SGN-E246516
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27832Clone name: cLEF-45-K9
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176765 is on microarray TOM1: SGN-S1-1-6.1.9.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176765 [TUS-24-M19] Trace: SGN-T193218 EST: SGN-E391892 Direction: 3' Facility: INRA
Clone: SGN-C176765 [TUS-24-M19] Trace: SGN-T197829 EST: SGN-E396503 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246516Length: 550 bp (1072 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246516 [] (trimmed) CAGATTCTCCACAACTAGAGAGGATTGCATCTCTTGATGCTCATAATTCGAAGATAAAGTGCACACTTTGGTGGCCAACAGGAAGGCATGACAAG
TTGGTTAGCATTGATGAACAGAATCTTTTCCTCTGGAGCTTTGATACTTCAAAGAAGAATGCACAGGTACAATCACAAGAATCAGCAGGTGTGCT
ACATTCGTTAACTGGGGGCGCCTGGGATCCCCATGATTATAATGCTCTGGCACTGACAAGTGAATCATCAGTCCAACTTTGGGATCTACGGACAA
TGAAGAAAACAAATTCAATCGATCATCCCCATGTCCGTAATTTGGATTACAATGTGAAGAGAGAGTATACTCTTGTAACGGCTGAAGATGAATCT
GGGATACATATATGGGATCTTAGAATGCTGAAGTTTCCAGTCCTTGATCTCCCTGGACATACTCACTGGACATGGACTGTCAAGTGCAATCCCGA
ACATGAAGACTTAATTCTGAGTGCTGGAACTGATTCTGCGGTCAATCTGTGGCTGGCTTCTCTTCCTAGTAGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246516] SGN-U568003 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61251 [Download] [View] Facility Assigned ID: TMGGU65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5