Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E246537

Search information 
Request: 246537Match: SGN-E246537
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27779Clone name: cLEF-45-I12
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176745 is on microarray TOM1: SGN-S1-1-2.4.9.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176745 [TUS-24-L23] Trace: SGN-T193151 EST: SGN-E391825 Direction: 5' Facility: INRA
Clone: SGN-C176745 [TUS-24-L23] Trace: SGN-T193398 EST: SGN-E392072 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246537Length: 538 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246537 [] (trimmed) AATACTTTTACTTGGCCCTCTGTATTTCTCTCTGTCGCCATTGTGTCACTGTTGCATAGTTTCTAGAGAGAGAAAGTGCAGAGTTTTTGTGTTGA
ATTGGAAGGAGAGAGAGAGAGAGTTGAGTTGAGGAAGGAGGAGTTCGCCGATGGGTCCATCGACGGCGACGACGGGGCAGAGCAACAGCAGTTAC
GATCTGTCATTTAAGATCTTGTTGATCGGAGATTCTGGAGTTGGAAAGAGTAGCTTGCTTGTTAGCTTCATTTCTAATGCCGTTGACGATCTGGC
CCCTACCATTGGCGTTGATTTTAAGATCAAGACACTCACTGTTAGTGGGAAAAAACTGAAGCTTACCATTTGGGACACAGCTGGGCAGGAGAGGT
TCAGGACACTGACAAGCTCCTACTACAGAGGTGCTCAAGGGATCATTCTTGTCTATGATGTAACAAGAAGAGAGACCTTCACAAACCTGTCTGAT
GTGTGGGCAAAAGAGGTGGAGCTGTATAGTAATAATCAGGATTGTGTAAAGATGCTGGTTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246537] SGN-U571016 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61272 [Download] [View] Facility Assigned ID: TMGGV54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5