EST details — SGN-E246544

Search information 
Request: 246544Match: SGN-E246544
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27822Clone name: cLEF-45-K16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176760 is on microarray TOM1: SGN-S1-1-3.1.9.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176760 [TUS-24-M14] Trace: SGN-T193349 EST: SGN-E392023 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246544Length: 542 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E246544 [] (trimmed) GCATATCTCGAGGTGTCTCTGTTACTACTGGAAGACTATGAGCCTCCAACACTTGCTTGTGCACTCAATGAAGTTCTGGCTTTGTTAGTAGGAGA
TGGGTTGTCAAATATGCCCACAATTGTAGCCCCTTTTGTTGTGGCTGCATCTAAGCTTAAGATGGAAAATAGAACTTCTGTTTCAATTGACAATA
GATCAGTTTATGGGTTGCAAGTAGGTGCCTCTAGTGACCTTACTAAAGCTTTGTGCACAAATTTGCAAAGCCCTCCCCCATCGTTGCAGATTTGT
AACGAACAGTTGGCCTGCCTACTTCAATTGGTTCGAGTCCTGAAGATGCCTACTTATGTTATAATTGGCAAAAAAGGTCAAAATTTGCATCGTAA
GACTTCGGAAGAGGAACACGAGGTGATACATGAGATAGGACAGCATTTGGCTAGCTTCTCATCTCTTAGTTTTTCAGGAGAAAAGATAGCCTGGG
ATGCAACAAAGTCTTCGAAAGAAACTCAAGAGCCTTGGCGTGCATTATATGGTTGAATCTTAATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246544] SGN-U571922 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61279 [Download] [View] Facility Assigned ID: TMGGV68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5