EST details — SGN-E246624

Search information 
Request: 246624Match: SGN-E246624
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27884Clone name: cLEF-45-N6
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176790 is on microarray TOM1: SGN-S1-1-5.2.9.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176790 [TUS-24-N20] Trace: SGN-T197531 EST: SGN-E396205 Direction: 3' Facility: INRA
Clone: SGN-C176790 [TUS-24-N20] Trace: SGN-T197532 EST: SGN-E396206 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246624Length: 447 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246624 [] (trimmed) TTATCTCTCCGGTACCCGTCAAGCTCCAGCGAGACATCATTCTCTTGCCCTTTGTCCGGAGCCACTTCCCATCTCCTTCGCAGCTGATCCTCCCC
ATCTTCATCTCCTCGCCGTCGAGAACAAATCTCCATCACCTACGTCTTCTATCTTCCATCTGTCTCCCCATCCATTTCATACACATAATAATATA
CTCATTTACACACCAATAGCTAATACTACGCGAACACTATCATATAACATTGGGGTGTTCTCTTATTAGCTGGATCGAGTCCGAGTGTGAGTTGG
ACCACGGATCCGTGATGACTATAGCCGAGGGAAGCCTTTACAGAGGTCAATCACGGAGAGAGAAACCTAGAGGACGTAATCAGGGGTTAACTCAA
CAGAAAAGGCAAGAAATAAGAGAGGCTTTTGAGCTTTTTGATACAGACAACTCTGGAACCATTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246624] SGN-U568735 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61359 [Download] [View] Facility Assigned ID: TMGGX75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0259 Quality Trim Threshold: 20.5