EST details — SGN-E246719

Search information 
Request: 246719Match: SGN-E246719
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27694Clone name: cLEF-45-D23
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246719Length: 744 bp (867 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E246719 [] (trimmed) CGACCATCAAATATCATCGGAGATTGGAAAGTAGGAAATTGTTTGAAATTTCACATCCGAATCGGAACATCGTCGGAGCTCCATCGGGCATCCGC
AAAGAGCTTCATCGTGGCTCCCTCAGGGTTACAACAACATCAAACTCTTACTAGAAGGAAATCAGCACCGCCGTCGACATTGAATCAAGCCGGTG
CATCGGGCTCGAAGCGAATAGTGCTGAAAGAATCCTCATCCGAATCGGACCTTGATCTTCCATTTTGGCAAAGAACCTGGTTCATTGTTCTCTTA
CTTCTCATGGCGATTTCCTTCTTCGGCCTAGCGCTTTTTCTTTTTCTCACCCTGGACTCTGATTACATATCAACAACACCTGTCTCCGCTGCTTC
CGAAGGCGTCCAGATTACATATGGATCCGCGATTAAGTTGATGCACGAGAAGACAAAGTTTCGGTTGCATTCCCATGATGTGCCATATGGTTCTG
GCAGTGGGCAGCAATCAGTCACTGGATTTCCCGGCGTAGATGATGCTAACAGCTACTGGGCTGTTAGGAGCACCGACTCGTCCAAGCAAGGTGAT
CCTATAAAGAGTGGAAGCATCATCAGGCTGCAACATATAAAGACAAGAAGATGGTTACATAGCCATTTGCATGCTTCTCCCATATCAGGAAATAT
GGAGGTCAGCTGCTTCGGTGATGACAAGGAATCTGATACAGGGGACTATTGGAGACTTGAAATTGAGGGCAGTGGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246719] SGN-U585061 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61454 [Download] [View] Facility Assigned ID: TMGGW24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5