Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E246724

Search information 
Request: 246724Match: SGN-E246724
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27731Clone name: cLEF-45-F21
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180601 is on microarray TOM1: SGN-S1-1-2.1.19.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246724Length: 730 bp (869 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E246724 [] (trimmed) GCCCTAGAGTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATT
ACTAAAGTACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTAT
CGATGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCGGAGAAATGGGGTTTTTTCCAAGTGGTTAATCATGGGATTC
CAACATCCGTCTTGGACAGAACGTTGCAAGGAACACGACAGTTCTTTGAGCAAGATAACGAGCTGCAAGTTGGAGAGACACGATTTTCTGTTACA
TGGCTCCGAATCCTCCCAGTCTACAAGAATTTCCAACTCCATGCGGTTTAAATTTCTAGATCCGCCACTGCTCAGTTGATTGACTATCTAAAGAC
AGCAAAAATTCCTAGATCTGTCGCTGCTCAGTTGATTGAGGAGTCATTAATAGACTTCTCCAAGGATGTGAAGAAACTGGGATTCACTTTACTTG
AATTATTGTCTGAAGGTCTCGGTCTCGATCGTAGTTATCTCAAAGATTATATGGATTGTTTTCATCTTTTCTGTTCTTGCAACTACTACCCACCA
TGTCCTCAGCCAGAACTCACCATGGGCACCATTCAACATACCGATATTGGTTTTGTAACGATCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246724] SGN-U577171 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61459 [Download] [View] Facility Assigned ID: TMGGW35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5