EST details — SGN-E246793

Search information 
Request: 246793Match: SGN-E246793
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26636Clone name: cLEF-41-C1
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C182289 is on microarray TOM1: SGN-S1-1-2.3.8.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246793Length: 607 bp (914 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E246793 [] (trimmed) ATCTGAGGGTGGTCATCAAGGAAGTATATATGCTGTTAGTTGGAGTCCCGATAGTAAACAGGTGCTCACAGTCTCTGCTGATAAGTCAGCAAAAG
TATGGGATATATCTGATGATGGAAAAGGGAAAGTGAAGAAAACACTGGCTTCTCCTGGTTCTGGTGGAGTTGAGGACATGCTAGTTGGCTGTCTC
TGGCAAAATGACCATCTTGTTACTGTTTCTCTTGGTGGAACTATTTCCATATTCTCAGCAAGTGATCTGGAAAAACCTCCCGTGTCATTTTCTGG
GCACATGAAAAATGTTAATTCCTTAGCTGTCCTCAGAAGTGACCCGAAAATCATATTGTCCACCAGTTATGATGGTTTGATTGTTAAATGGATTC
AAGGCATTGGATATAGCGGGAAATTAGACCGAAAGGTGACTTCTCAAATCAAATGCTTTGCAGTTGTGGAAGGAGAACTTGTGTCATGTGCGTTC
GACAACAAGATCTGGAGAGTATCTCTGCTTGGAGATCAATGTGGAGATGCAAATTCTATAGATGTTGGCACCCAACCTAAGGACTTAAGCCTTGC
CTTAATTCTCCTGAAGTGACTTTAGTTTCGTTTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246793] SGN-U568055 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60208 [Download] [View] Facility Assigned ID: TMGGE13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5